Genetics: Easter Egg Genetics

Students use plastic eggs to practice their Punnet square-solving-skills. 

Each egg color has been assigned a genotype:

• Blue - BB
• Green - Bb
• Yellow - bb

(This example uses incomplete dominance - i.e. Bb appears green, not blue, as it would in a straight dominant/recessive situation). 

The eggs have been mixed and matched to create various genetic crosses.  For example, a blue half matched with a green half would represent BB x Bb. 

Students use a Punnet square to solve the cross, and then open the egg to check their work. 

Teacher Notes:
This activity has nothing to do with Easter, but the eggs are only available at that time of year.  Check your local grocery store, big-box store, drugstore, etc. at the end of the month for eggs on clearance.  Get them now, and you'll have them for whenever you want to do the activity.

The original activity, Easter Egg Genetics, is part of the Access Excellence Activities-To-Go Collection.  If you visit the original, you'll find a guide for filling all of the various egg combination, which will save you a few minutes of precious time. 

http://www.middleschoolscience.com/ has a student worksheet to accompany the activity (and she also includes the egg-filling guide with her teacher notes), which can be found here. 

You can fill the eggs with appropriately colored candy, which is a lot of fun if you are giving each student one (or maybe 2) eggs as a quick assessment.  If you want each student to work their way through more eggs (and you don't want the hassle of refilling the eggs), use appropriately colored objects - counting chips, pieces of construction paper, centimeter cubes, etc.  The students can replace the objects after they check their work and you're all set for next time.

DNA: Codon Bingo

Have your students fill in a blank Bingo card with amino acids - there aren't enough amino acids to fill a regular 5x5 card, so allow students to use each amino acid up to 2 times or use a smaller card.

Get 12 ping pong balls or practice golf balls.  Write A on three of them, C on three, G on three, and U on the last three.  Be careful... because the balls don't have an "up" side, C and U can look similar - you might want to put a line underneath each letter.  Place the ping pong balls into a bag or a hat.

Now play Bingo - pull 3 balls out of the bag, one at a time.  Have students translate those three letters into an amino acid and mark it on their Bing card if needed.

Return the balls to the bag, give it a shake and repeat.

You could write out all the 3 base combinations and pull them out of a bag, but I think the balls are more fun!   It would be even more fun if I could get my hands on one of those lottery/Bingo ball machines...

Natural Selection: Can you find me?

Mark off a 1 square meter (or yard) section of grass. Scatter a selection of colored toothpicks in the marked off area – you will want to count the number of toothpicks of each color before you scatter them.

Provide a group of students with ~15 seconds to pick up as many toothpicks as they can find. Count and record the number of each color that was collected. Repeat this exercise several more times.

After returning inside, students can graph the data. You should find that the green toothpicks were found in smaller numbers, especially in the early trials.

Comparing Amino Acids & DNA

A quick review...
DNA provides instructions for the assembly of amino acids into protein.

Therefore...
Similar proteins have a similar amino acid sequence.  And if the amino acid sequence is similar, the DNA is similar.

Scientists believe that similar DNA sequences indicate a common origin.

Hemoglobin (a protein in red blood cells) is one protein that has been studied in humans, gorillas, and horses.


Procedure:
Each group will be given 10 different colors of beads (each one representing a different amino acid - see list below).

Students use the beads to create the partial amino acid sequence for human, gorilla and horse hemoglobin (see below).

For assembly purposes, I give the students an index card with three pipe cleaners attached.  It keeps it all in one place, and it makes it easy for the students to compare the sequences at the end.

After students have completed the amino acid sequences, I use my keys to quickly check their work.

They then count and record the differences in the amino acid sequence.

From there, you can discuss...
--what determines the order of amino acids?
--where do we get our DNA from?
--where did our parents get their DNA from?
--random chnages in DNA occur over time, the mroe time passes, the more changes there will be.

At the end of the activity, students remove thier beads and return them to their appropriate bag.


The Amino Acid Sequences:
Human: gly lys val asp val asp glu val gly gly glu lys leu his val asp pro glu asp phe arg leu

Gorilla: gly lys val asp val asp glu val gly gly glu lys leu his val asp pro glu asp phe leu leu

Horse: asp lys val asp glu glu glu val gly gly glu lys leu his val asp pro glu asp phe arg leu

******
This activity comes from a wonderfully creative and talented teacher who presented it in a workshop at the New Jersey Science Teachers Association Convention.  Unfortunately, I don't have her name written down.  If you know her, or are her, please contact me and I will give her all the credit in the world for this great activity!

DNA: A Beaded Protein

Here's a fun way to test your students ability to translate DNA bases into amino acids...

I wrote out about 9 different strings of DNA bases (I just typed A, C, G, T at random).
For example:
ACTGTATGCTTGATGATGCGTAATGCTAGTTCCTGATGCTAGC

Each student was given one of the strands of DNA.  She then needed to determine the amino acids coded for by that DNA.

The student then went to a station where there were beads - one color for each amino acid. 

The appropriate beads were strung onto a length of lanyard lacing attached to an index card. 

After the amino acid sequence was complete, the student brought me the completed protein, which I quickly compared to my completed strands (pictured above).  It was quick and easy to check their work. 

I had students return the beads to the appropriate bags after they finished.  You could let yours turn their protein into a key chain, if you were so inclined. 

Mutation Game

Place a plate of candy or beads in the center of the room.

Each team of students has a nest (a paper cup or plate).  Each team also has a means of picking up their food - forks or spoons.  But, each team also has a mutation - missing fork tongs, bent handles, extra large or small size, etc.  You may wish to leave one team un-mutated, for the sake of comparison.

During the course of the game, students on each team take turns making trips to the food supply to bring food back to the nest.  The goal is to get as much food back to the nest as possible before time runs out.  Any food that falls to the ground is out and can no longer be used.

Turn Your Students Into a Protein

This one takes a little prep work the first time 'round.  But after that, you're set forever.  It's a great way to include a little kinesthetic activity into the study of DNA.

First, the prep work: 
On a long strip of paper* write out a string of DNA bases (actually, you're making the mRNA).  You want to make sure your letters are evenly spaced - I actually marked the paper.

Keep a codon chart handy - make sure you begin with a start codon and don't come to a stop codon immediately.  And, don't make the mistake of using T instead of U, as someone did...

Now you need to make a ribosome through which your strip of paper can fit.  I made mine out of fun foam.  It has magnets on the back, so it sticks to the white board.  Cut the window in the ribosome, so that you can see 3 bases at a time (hence the reason for evenly spacing your letters).  Use this picture to guide you:

Now you need to make the amino acids.  Once again I used fun foam.  I wrote the amino acid on the foam, punched holes in it and strung string through the holes so the students could wear them. 

For the activity: 
Draw a huge circle on the board - a cell.  Sketch in a nucleus and stick your ribosome in the middle as well. 

Show your students the mRNA (your paper strip) moving from the nucleus to the ribosome.

Feed the mRNA into the ribosome.

Have your students translate the first 3 mRNA bases into an amino acid.

Have a student put the appropriate amino acid placard on and stand in front of the room.

Move the mRNA to the next three bases.  Determine the amino acid.  Have another student put on the appropriate placard, then stand next to the first student and hold his/her hand.

Proceed this way until you come to a stop codon, or until you've made your point.

Your students will have a better feel for how a ribosome translates mRNA, how proteins are formed, and understand that proteins are long chains of amino acids. 

* I got a few sentence strips from an elementary teacher in my building - they're the perfect size and shape for this, I didn't have to cut them, and they have lines marked on them!

******
I learned this from a fellow teacher at a NJ Science Teachers Association Convention several years ago.  I don't know who that teacher is - but if you're out there, please let me know - I'd like to give you credit.

Animal Adaptations: Baby Birds

Here's a game for younger students learning about animal adaptations.

Divide students into group - you'll want 4 or 5 students per group.  Select one student in each group to serves as the mama/papa bird; the rest will be baby birds.

The mama/papa will be responsible for going to the food supply (a plate of pretzel sticks in the middle of the classroom), bringing back a piece of food and feeding it to the loudest baby bird.

The baby birds will be responsible for squawking loud enough to get fed ahead of their bird siblings.


Play the game for several minutes - be prepared for a very loud classroom!

Then, talk about what happened - the birds who squawked the loudest got the most food.  These birds will grow big and strong and some day have baby birds of their own - probably babies who are loud squawkers.  The babies who didn't get as much food to each might not fare as well. What might happen if a baby bird is born and unable to squawk at all? 

While squawking volume is not, to my limited knowledge, a trait that is regularly selected for, this game does introduce the ideas of adaptations, genetics, and trait selection to young children in a context they can understand.

******
Idea from Anna McGhee, with many thanks!

Genetics: Penny Flip

Use this activity to make the Punnett Square percentages come to life.

For this example, I'm using two heterozygous parents: Rr x Rr. 

Each student/pair of students will need two pennies - one for each parent. 

Use a small piece of masking tape to write the genotype on the pennies - one letter of the genotype goes on each side of the penny.

Then start flipping your pennies and tallying the results.  One student could flip both pennies, or if working in pairs, have each student flip one. 

They should be able to get a lot of flips in very quickly and amass a good set of data.  It's amazing how close they'll come to the 25% - 50% - 25% results.  It's even more striking when you combine the whole class data. 

I actually did it and that's how it worked out - I didn't make up the data! 

For students who are still struggling, have them use the pennies to do other crosses:
RR x rr
RR x RR
rr x rr
and so on

I find that this activity helps students begin to understand what offspring are possible from given parents.  It also helps drive home the point that each parent contributes one gene to the offspring.


You could just have them use heads and tails, but marking the genotypes makes it much clearer (especially for struggling students, for whom this activity is the most beneficial).

Genetics: SpongeBob Genetics

If you haven't visited Science Spot yet, you really do need to get there. 

One of the most popular (at least by my unofficial survey of people I talk to and come in contact with) items found there is the SpongeBob genetics worksheets (scroll about half way down the page).  My students LOVE these, and they provide good practice with phenotypes, genotypes, Punnett Squares, etc.  And, of course, she includes an answer key with each worksheet. 

I just hope SpongeBob remains popular for a long, long time! 

Do yourself a favor and get over to the Science Spot!