DNA: A Beaded Protein

Here's a fun way to test your students ability to translate DNA bases into amino acids...

I wrote out about 9 different strings of DNA bases (I just typed A, C, G, T at random).
For example:
ACTGTATGCTTGATGATGCGTAATGCTAGTTCCTGATGCTAGC

Each student was given one of the strands of DNA.  She then needed to determine the amino acids coded for by that DNA.

The student then went to a station where there were beads - one color for each amino acid. 

The appropriate beads were strung onto a length of lanyard lacing attached to an index card. 

After the amino acid sequence was complete, the student brought me the completed protein, which I quickly compared to my completed strands (pictured above).  It was quick and easy to check their work. 

I had students return the beads to the appropriate bags after they finished.  You could let yours turn their protein into a key chain, if you were so inclined.