Mapping: Make a Topographic Map

Give each group of students a can of Play-Doh.  Have them shape the Play-Doh into a mountain - they can be creative, but simpler is better.

Use a skewer or a straw to poke a hole all the way through the mountain - that's the reference point.

Use a rule to make marks on the side of the mountain every centimeter.

Use dental floss to cut off the bottom slice of the mountain, cutting at the mark you made.

Place the slide on a piece of paper.  Trace around the slice and make a mark where the hole is.

Cut the next slice off the bottom of the mountain.

Place the slide on the paper, lining up the hole in the Play-Doh with the mark on the paper.  Trace around the slice.

Continue in this manner until all the slices have been traced.

You now have a topographic map of your Play-Doh mountain.

Trade maps with another group and see if you can recreate each other's mountains using Play-Doh!

Step Through an Index Card

Here's a challenge to throw at your students: Hand them each an index card and a pair of scissors and tell them to find a way to step through their card (their whole body needs to pass through the card).  [You could use a piece of paper instead of the index card, it's just not quite a dramatic.]

Here's how it's done...
(Well, one way it can be done.  I wouldn't be surprised if your students came up with another). 

Fold the card in half, length-wise.

Make cuts, as shown below.

Unfold the card and cut along the fold.  BUT, do not cut the two end sections!!

Gently pull the card apart and you'll have a loop you can step/pass through.

Basic Not Boring Workbooks

There comes a time when every teacher needs to use worksheets.  Some use them more readily than others, but everyone uses them some of the time.  

I like the worksheets found in the Basic Not Boring series.  They show a great variety of work (not the same sheet over and over again with different information plugged into it) and the fonts and sketches are more fun than basic text.  The work is intended for students in grades 6-8, and I have found it to be age and developmentally appropriate for my students.

Of course, it's unlikely that anything in these books is going to match your curriculum perfectly, since they aren't connected to a specific curriculum, but I've found them to be a good resource when I need something more.  

I have used:

Earth and Space Science

Life Science

 Physical Science

Human Body & Health

If you teach other subject areas, you can find books from the same series for math, history and language arts.

Oobleck

Begin your class by reading Bartholomew and the Oobleck by Dr. Seuss.

Then have your students make their own Oobleck:
--Mix 3 spoonfuls of cornstarch with 2 spoonfuls of water. 

Next comes play time...
Students stick their hands in the Oobleck to see what it feels like and how it behaves.  They should try some of these other tests as well, recording their results after each one:
--Poke it quickly
--Poke it slowly
--Stir it fast
--Stir it slowly
--Pour it
--Roll it into a ball
--Set objects on it

Now students need to decide if the Oobleck is a solid or a liquid.  Make them defend their decision in a written statement.  Perhaps you'll even get a debate going between students. 

You've actually created a suspension that acts as both a solid and a liquid.

**Do NOT try to get rid of your Oobleck by putting it down the drain - just put it in the trash.  Or better yet, allow the water the evaporate and put the dried cornstarch in a plastic bag for your next batch of Oobleck.

DNA: A Beaded Protein

Here's a fun way to test your students ability to translate DNA bases into amino acids...

I wrote out about 9 different strings of DNA bases (I just typed A, C, G, T at random).
For example:
ACTGTATGCTTGATGATGCGTAATGCTAGTTCCTGATGCTAGC

Each student was given one of the strands of DNA.  She then needed to determine the amino acids coded for by that DNA.

The student then went to a station where there were beads - one color for each amino acid. 

The appropriate beads were strung onto a length of lanyard lacing attached to an index card. 

After the amino acid sequence was complete, the student brought me the completed protein, which I quickly compared to my completed strands (pictured above).  It was quick and easy to check their work. 

I had students return the beads to the appropriate bags after they finished.  You could let yours turn their protein into a key chain, if you were so inclined. 

Earth's Water Necklace

I use this as a follow-up to ProjectWET's A Drop in the Bucket* demonstration.

Each student will need:
-97 blue beads
-2 white beads
-1 green beads

Students string their beads onto a length of lanyard lacing.  They can string them in any order - I happen to prefer the symmetric approach, but the white and green beads can be placed anywhere on the cord.

The beads represent all the water on the planet.  The blue beads are salt water.  The white beads are frozen water.  The green bead is liquid fresh water. 

It's a great visual reminder of how precious a resource fresh water is.  I've done this activity with students as young as preschool (I count out the 97 beads for them) and as old as 6th grade. 



*You start with 1000 ml of water - that's all the water in the world.  Pour out 30 ml.
970 ml are salt water.  30 ml are fresh water.
From the 30 ml, pour out 6 ml.
24 ml are ice.  6 ml is liquid fresh water.
From the 6 ml pick up 1 ml.
5 ml are unusable (pollution, etc.).  1 ml is usable water.

So in summary:
970 ml - salt water
24 ml - trapped as ice
5 ml - polluted or otherwise unusable
1 ml - water usable for human consumption

Air Pressure: Dry Paper

Fill a tub or small aquarium with water (the water should be deeper than the cup you're planning to use for this activity).

Crumple up a sheet of paper and place it in the bottom of a cup (use enough paper so it will stay in the bottom when the cup is turned over.

Hold the cup upside down and push it into the water.

Pull the cup up and out of the water.  Remove the paper.  Is it wet or dry?  Why?

The cup was filled with air.  When you pushed the cup into the water, you trapped the air in the cup.  The air pushed on the water, pushing it out of the way of the cup.  As a result, the paper stayed dry.