Basic Not Boring Workbooks

There comes a time when every teacher needs to use worksheets.  Some use them more readily than others, but everyone uses them some of the time.  

I like the worksheets found in the Basic Not Boring series.  They show a great variety of work (not the same sheet over and over again with different information plugged into it) and the fonts and sketches are more fun than basic text.  The work is intended for students in grades 6-8, and I have found it to be age and developmentally appropriate for my students.

Of course, it's unlikely that anything in these books is going to match your curriculum perfectly, since they aren't connected to a specific curriculum, but I've found them to be a good resource when I need something more.  

I have used:

Earth and Space Science

Life Science

 Physical Science

Human Body & Health

If you teach other subject areas, you can find books from the same series for math, history and language arts.

Oobleck

Begin your class by reading Bartholomew and the Oobleck by Dr. Seuss.

Then have your students make their own Oobleck:
--Mix 3 spoonfuls of cornstarch with 2 spoonfuls of water. 

Next comes play time...
Students stick their hands in the Oobleck to see what it feels like and how it behaves.  They should try some of these other tests as well, recording their results after each one:
--Poke it quickly
--Poke it slowly
--Stir it fast
--Stir it slowly
--Pour it
--Roll it into a ball
--Set objects on it

Now students need to decide if the Oobleck is a solid or a liquid.  Make them defend their decision in a written statement.  Perhaps you'll even get a debate going between students. 

You've actually created a suspension that acts as both a solid and a liquid.

**Do NOT try to get rid of your Oobleck by putting it down the drain - just put it in the trash.  Or better yet, allow the water the evaporate and put the dried cornstarch in a plastic bag for your next batch of Oobleck.

DNA: A Beaded Protein

Here's a fun way to test your students ability to translate DNA bases into amino acids...

I wrote out about 9 different strings of DNA bases (I just typed A, C, G, T at random).
For example:
ACTGTATGCTTGATGATGCGTAATGCTAGTTCCTGATGCTAGC

Each student was given one of the strands of DNA.  She then needed to determine the amino acids coded for by that DNA.

The student then went to a station where there were beads - one color for each amino acid. 

The appropriate beads were strung onto a length of lanyard lacing attached to an index card. 

After the amino acid sequence was complete, the student brought me the completed protein, which I quickly compared to my completed strands (pictured above).  It was quick and easy to check their work. 

I had students return the beads to the appropriate bags after they finished.  You could let yours turn their protein into a key chain, if you were so inclined. 

Earth's Water Necklace

I use this as a follow-up to ProjectWET's A Drop in the Bucket* demonstration.

Each student will need:
-97 blue beads
-2 white beads
-1 green beads

Students string their beads onto a length of lanyard lacing.  They can string them in any order - I happen to prefer the symmetric approach, but the white and green beads can be placed anywhere on the cord.

The beads represent all the water on the planet.  The blue beads are salt water.  The white beads are frozen water.  The green bead is liquid fresh water. 

It's a great visual reminder of how precious a resource fresh water is.  I've done this activity with students as young as preschool (I count out the 97 beads for them) and as old as 6th grade. 



*You start with 1000 ml of water - that's all the water in the world.  Pour out 30 ml.
970 ml are salt water.  30 ml are fresh water.
From the 30 ml, pour out 6 ml.
24 ml are ice.  6 ml is liquid fresh water.
From the 6 ml pick up 1 ml.
5 ml are unusable (pollution, etc.).  1 ml is usable water.

So in summary:
970 ml - salt water
24 ml - trapped as ice
5 ml - polluted or otherwise unusable
1 ml - water usable for human consumption

Air Pressure: Dry Paper

Fill a tub or small aquarium with water (the water should be deeper than the cup you're planning to use for this activity).

Crumple up a sheet of paper and place it in the bottom of a cup (use enough paper so it will stay in the bottom when the cup is turned over.

Hold the cup upside down and push it into the water.

Pull the cup up and out of the water.  Remove the paper.  Is it wet or dry?  Why?

The cup was filled with air.  When you pushed the cup into the water, you trapped the air in the cup.  The air pushed on the water, pushing it out of the way of the cup.  As a result, the paper stayed dry.

Boat Races

Cut out a boat shape from an index card or piece of thin cardboard.

Cut a small notch out of the back of the boat.

Float the boat in a tub of water.  What happens?  Not much!

Now, place a small sliver of soap in the notch and watch.  What happens?  The boat moves across the tub!

Why?
Without soap, the water pulls on the boat from all directions, resulting in little to no movement.  When the soap is added, it reduces the pull of the water at the back of the boat.  The pull at the front of the boat remains  strong and you see movement. 

Students can experiment with boat shape to find the fastest (and straightest) racer!

Because the soap reduces the water's surface tension, the water in the tub will need to be dumped out and replaced often.

Solubility Fireworks

Fill a tall bottle most of the way with water.

Place about a tablespoon of cooking oil in a cup.  Add a few drops of different colors of food coloring and stir them into the oil as best you can. (Limit yourself to one or two colors of food coloring - I used a bunch and it just ended up looking black - not what I was going for!)

Pour the oil onto the water in the bottle and observe.

There are a few lessons to be gleaned from this fun demonstration:
--Oil is less dense than water (i.e. it floats on the water)
--Food coloring is a polar substance, oil is non-polar (food coloring doesn't dissolve in the oil)
--Food coloring and water are both polar substances (food coloring dissolves in the water)